WormBase Tree Display for Construct: WBCnstr00019767
expand all nodes | collapse all nodes | view schema
WBCnstr00019767 | Summary | [jmjd-3.1p::jmjd-3.1::mCherry] |
---|---|---|
Driven_by_gene | WBGene00017571 | |
Gene | WBGene00017571 | |
Fusion_reporter | mCherry | |
Type_of_construct | Translational_fusion | |
Construction_summary | The jmjd-3.1p::jmjd-3.1::mCherry transgenic plasmid included 2.7 kb of jmjd-3.1 promoter driving the full-length jmjd-3.1 isoform b (longest variant) cDNA with mCherry fused to the C-terminus. jmjd-3.1 cDNA was amplified by PCR using the following primers F: ATGCAAGGGAAAAATTCACACTTGAC and R:ATTTTTGATGCCTACGTTCCTAAT and sub-cloned into pGEM-T easy. | |
Reference | WBPaper00045660 |