WormBase Tree Display for Construct: WBCnstr00019717
expand all nodes | collapse all nodes | view schema
WBCnstr00019717 | Summary | [UNC-23::YFP] |
---|---|---|
Driven_by_gene | WBGene00006760 | |
Fusion_reporter | YFP | |
Type_of_construct | Translational_fusion | |
Construction_summary | The coding sequence of H14N18.1, obtained from Open Biosystems (Thermo Scientific, Darmstadt, Germany) was amplified and inserted into the reporter construct in frame to YFP with the following primers: UNC-23 YFP fusion forward: ATTGCAGCTAGCATGTTTCAGAACATACCAATCAAAATAC and UNC- 23 YFP fusion back: CAGCCTGCTAGCTTCGCTTTGATCATCCATC. | |
Clone | pPD95.79 | |
Reference | WBPaper00045536 |