WormBase Tree Display for Construct: WBCnstr00017614
expand all nodes | collapse all nodes | view schema
| WBCnstr00017614 | Summary | [Pflcn-1::flcn-1::flcn-1(3'UTR); Pmyo-2::dsRed] | |
|---|---|---|---|
| Driven_by_gene | WBGene00017699 | ||
| Gene | WBGene00017699 | ||
| UTR_3 | WBGene00017699 | ||
| Construction_summary | A 2000 bp region upstream of the flcn-1 gene was amplified from genomic DNA using the following primers containing Gateway recombination sites: fp GGGG ACA ACT TTG TAT AGA AAA GTT G atgacgtcaccagttctt and rp GGGGACTGCTTTTTTGTACAAACTTGTC atttgaattctgtaaaaacatgaattt. The amplified product was recombined into pDONR P4-P1R (Invitrogen) according to the manufacturer's protocol (pEntr_flcn-1 (prom)). The CDS of flcn-1 was PCR amplified from C. elegans WT N2 cDNA using the following primers: fp GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTG CAA GCA GTA ATA GCA CTT TG and rp GGG AC CAC TTT GTA CAA GAA AGC TGG GT tctaga ctc ggtacc ctc ctcgag A ACG AGC AGT AGA GGT TTG (lower case indicating an inserted multiple cloning site). The amplification product was recombined into pDONR 221 (Invitrogen) according to the manufacturer's protocol (pEntr_flcn-1 (ORF)). The region corresponding to the flcn-1 3'UTR was synthesized as a minigene (IDTDNA) and inserted into pEntr_flcn-1 (ORF) at the 3' end of the flcn-1 CDS using the Xho-1 and Xba-1 sites resulting in pEntr_flcn-1::3'UTR. The plasmid used for generation of TMB100 was the result of the recombination of pEntr_flcn-1 (prom) and pENTR_GFP into pDESTDD03 (generous gift from Denis Dupuy, (Dupuy et al. 2004)) resulting in pRM101.The destination vector pPB1 was derived from the vector pRG5271 neo (Addgene plasmid 26387, (Giordano-Santini et al. 2010)). Briefly, the recombination cassette attR4-ccdB-attR2 (Multisite gateway, Invitrogen) was PCR amplified from the pDESTDD03 with the following primers: fp acgt GAAGACA CCCGG TTGATGGGGAGAATTTTTCAA and rp acgt GAAGACA CCCGGG TGTGGAATTGTGAGCGGATA and cloned into the Xma-1 site of pRG5271neo. The plasmid used for generating TMB101 was the result of the recombination of pEntr_flcn-1 (prom) and pENTR_flcn-1::3'UTR into pPB1 resulting in pPB101. | ||
| Used_for | Transgene_construct | WBTransgene00018226 | |
| Reference | WBPaper00042236 |
