WormBase Tree Display for Construct: WBCnstr00014362
expand all nodes | collapse all nodes | view schema
| WBCnstr00014362 | Public_name | fUL#HC93 | |
|---|---|---|---|
| Other_name | Expr9842_Ex | ||
| Summary | [F26H11.2::GFP; pRF4] | ||
| Driven_by_gene | WBGene00009180 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC93. The reporter gene fusion assayed was made by recombineering fUL#HC88 (WRM0610dH04/WRM0629dF11). Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: gctattcccaactagatttctagatcctatccatctgaaaatttgaaaaa, tgtgatggtgcagtgtaggttgcagtaggcagaataacagttcggagaac. gfp was inserted immediately after the start codon of nurf-1f. This large gene was reconstructed by joining two fosmids together by recombineering before inserting the gfp. pRF4 cotransformant: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031287 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
