WormBase Tree Display for Construct: WBCnstr00014348
expand all nodes | collapse all nodes | view schema
| WBCnstr00014348 | Public_name | fUL#HC95 | |
|---|---|---|---|
| Other_name | Expr9828_Ex | ||
| Summary | [F26H11.2::GFP; pRF4] | ||
| Driven_by_gene | WBGene00009180 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC95. The reporter gene fusion assayed was made by recombineering fUL#HC88 (WRM0610dH04/WRM0629dF11). Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: gttcactggtgcaaagccgatatacgaggatctgtatccgtttttaatct, gactaagttaaaactcattcacctggcagaaaaaagacgtgtagggcctt. gfp was inserted immediately after the start codon of nurf-1e. Other strain: UL4028. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031273 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
