WormBase Tree Display for Construct: WBCnstr00014341
expand all nodes | collapse all nodes | view schema
| WBCnstr00014341 | Public_name | fUL#HC107 | |
|---|---|---|---|
| Other_name | Expr9821_Ex | ||
| Summary | [F13G11.1::GFP; pRF4] | ||
| Driven_by_gene | WBGene00007058 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC107. The reporter gene fusion assayed was made by recombineering WRM062dC10 . Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: cttttgctctccttccgtacatatctcaaattcccaattctttcagtaaa, tgatgatgatgctcgtcgtcgatggttacagtagcgatgatgtgtgggct. gfp was inserted after the start codon of dmd-6b. The upstream primer contains 1 extra adenine at the 3' end of the upstream homology arm, directly upstream of the gfp, to shift the translational reading frame and stop any reporter expression arising from dmd-6a or any other transcripts with upstream exons spliced onto the exon targeted in this fusion. Other strain: UL4085. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031266 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
