WormBase Tree Display for Construct: WBCnstr00014323
expand all nodes | collapse all nodes | view schema
WBCnstr00014323 | Public_name | fUL#JW142 | |
---|---|---|---|
Other_name | Expr9803_Ex | ||
Summary | [ZK867.1::GFP; pRF4] | ||
Driven_by_gene | WBGene00044068 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#JW142. The reporter gene fusion assayed was made by recombineering WRM063aH01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: tactctttctcacgttccatttccattttcagtctgtactcctctcattg, tgattttgtctacttactcgatccattcccactggtgcatcggttgactt. gfp was inserted directly upstream of the syd-9c stop codon. In addition a base pair was inserted into exon 2 to disrupt the translational reading frame and knockout any reporter expression arising from syd-9d (changing ..tactcctctcattgaagtcaaccg.. to ..tactcctctcattgtaagtcaaccg.. ). Other strains: UL3837, UL3838. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031248 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |