WormBase Tree Display for Construct: WBCnstr00014288
expand all nodes | collapse all nodes | view schema
WBCnstr00014288 | Public_name | fUL#JW96 | |
---|---|---|---|
Other_name | Expr9768_Ex | ||
Summary | [T24H10.7::GFP; pRF4] | ||
Driven_by_gene | WBGene00012005 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#JW96. The reporter gene fusion assayed was made by recombineering WRM0641aE11. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ttgttcttactcgaaatcattctttccttttttccaccattctcatcacc, atatttgaattcattagagaattcatccattgtggtggctgatagtttaa. gfp was inserted immediately after the jun-1e start codon. Fosmid was chosen because it contains both jun-1 and the next downstream gene, C16D2.1, which together form an operon. Other strains: UL3514, UL3516. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031213 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |