WormBase Tree Display for Construct: WBCnstr00014257
expand all nodes | collapse all nodes | view schema
| WBCnstr00014257 | Public_name | fUL#JW148 | |
|---|---|---|---|
| Other_name | Expr9737_Ex | ||
| Summary | [F16B4.12::GFP; pRF4] | ||
| Driven_by_gene | WBGene00003707 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#JW148. The reporter gene fusion assayed was made by recombineering WRM067cC10. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ccctcacctcagttttaaaattttgtttaaagcacatttctttacagaaa, taattggaacttgtcgacgatgaggcagaacagaaatcgatagaattttg. gfp was inserted immediately after the nhr-117 start codon. Other strains: UL3205, UL3403. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031182 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
