WormBase Tree Display for Construct: WBCnstr00013809
expand all nodes | collapse all nodes | view schema
| WBCnstr00013809 | Other_name | Expr9223_Ex | |
|---|---|---|---|
| Summary | [chd-3p::DsRed2] | ||
| Driven_by_gene | WBGene00000482 | ||
| Fusion_reporter | DsRed2 | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [chd-3p::DsRed2] transcriptional fusion. 9 kb of chd-3 genomic promoter with about 100 bp of first exon were amplified with Finnzyme Phusion polymerase. Primers: chd-3attB1left ggggacaagtttgta caaaaaagcaggctccttacgggcaatcattgag, chd-3attB2trcr ggggaccactttgtacaagaaagctgggtcgttcttcgccgacatcttcttc. PCR products were recombined with pDONR201 by Invitrogen Gateway BP recombination. pENTR-chd-3p was recombined with pDEST- DsRed2 by LR reaction. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00030989 | |
| Reference | WBPaper00037765 |
