WormBase Tree Display for Construct: WBCnstr00012258
expand all nodes | collapse all nodes | view schema
| WBCnstr00012258 | Other_name | Expr4819_Ex | |
|---|---|---|---|
| Summary | [unc-1::DsRED2] | ||
| Driven_by_gene | WBGene00006741 | ||
| Fusion_reporter | DsRed2 | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [unc-1::DsRED2] transcriptional fusion. The in vivo-homologous-recombination approach was used to express Punc-1::DsRED2 so that the entire promoter could be included. Specifically, a fragment of 1.1 kb Punc-1 (immediately upstream of the initiation site) was amplified from the cosmid K03E6 by polymerase chain reaction (PCR) (sense primer: TTAAGATCTTGGTCAGTGAAAATTAC; antisense primer: GAACCGGTGACATTTACCTGGAAAACTT) and fused to DsRED2 in the pHC183 vector. This plasmid (wp486) was coinjected with the cosmid K03E6, which contains the entire unc-1 gene, into the syncytial gonad of wild-type worms after linearization. Transformed animals were identified on the basis of DsRED2 fluorescence with a Zeiss fluorescence stereomicroscope (M2BIO). --precise ends. | ||
| Clone | K03E6 | ||
| Used_for | Transgene_construct | WBTransgene00029469 | |
| Reference | WBPaper00030879 |
