WormBase Tree Display for Construct: WBCnstr00012005
expand all nodes | collapse all nodes | view schema
WBCnstr00012005 | Other_name | Expr4441_Ex | |
---|---|---|---|
Summary | [grl-2::gfp] | ||
Driven_by_gene | WBGene00001711 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [grl-2::gfp] transcriptional fusion. Primer A* (5' TGAACTTACCACACCTGCACA 3') and Primer B (5' AGTCGACCTGCAGGCATGCAAGCTAAGTGCAGTTAGGATACTTGGTA 3') were used to generate a 2981 bp promoter fragment. --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00029218 | |
Reference | WBPaper00028754 |