WormBase Tree Display for Construct: WBCnstr00011994
expand all nodes | collapse all nodes | view schema
| WBCnstr00011994 | Other_name | Expr4431_Ex | |
|---|---|---|---|
| Summary | [grd-5::gfp] | ||
| Driven_by_gene | WBGene00001694 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [grd-5::gfp] transcriptional fusion. Primer A* (5'ACTGTGTGAAGTAAACCGAAATGA 3') and Primer B (5' AGTCGACCTGCAGGCATGCAAGCTACGATGAGTGAACGGATTTCT 3') were used to generate a 2885 bp promoter fragment. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00029207 | |
| Reference | WBPaper00028754 |
