WormBase Tree Display for Construct: WBCnstr00011282
expand all nodes | collapse all nodes | view schema
| WBCnstr00011282 | Other_name | Expr3280_Ex | |
|---|---|---|---|
| Summary | [coelomocyte-specific promoter::cup-4::gfp] | ||
| Driven_by_gene | WBGene00000845 | ||
| Gene | WBGene00000845 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [coelomocyte-specific promoter::cup-4::gfp] translational fusion. To make a functional CUP-4 GFP fusion, site-directed mutagenesis was used to introduce adjacent restriction sites for XhoI and EcoRV in pJF148 (primers GGATTTCAAAATCCAAAACGTCGATATCGCTAGCCTCGAGTCAAGCTCAGCACTTTACTA and TAGTAAAGTGCTGAGCTTGACTCGAGGCTAGCGATATCGACGTTTTGGATTTTGAAATCC). GFP(S65T) lacking introns was then PCR amplified (primers CACACAGATATCATGAGTAAAGGAGAAGAACTTTTC and CACACACTCGAGTTTGTATAGTTCATCCATGCC) and inserted into those sites. Finally, the whole open reading frame was cloned in front of a coelomocyte-specific promoter. --precise ends. | ||
| Clone | pJF148 | ||
| Used_for | Transgene_construct | WBTransgene00028501 | |
| Reference | WBPaper00025238 |
