WormBase Tree Display for Construct: WBCnstr00011188
expand all nodes | collapse all nodes | view schema
| WBCnstr00011188 | Other_name | Expr3168_Ex | |
|---|---|---|---|
| Summary | [gana-1::gfp] | ||
| Driven_by_gene | WBGene00011095 | ||
| Gene | WBGene00011095 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [gana-1::gfp] translational fusion. The entire coding region of the gana-1 gene, including 3 kb of its 5'upstream sequence, was amplified from N2 genomic DNA with two pairs of primers: the external pair (5'GTGAGAGTGGGGAGATAGAA and 5'TCAATTTGCTTGAGGTACATA) and the internal primers, with overhangs containing SphI and SalI restriction sites respectively (5'ACATGCATGCAACTTTCACAGGAACACAAC and 5'CGACGTCGACAATTGAACTCTATTGGTTCTCAA). The amplified DNA fragment (4709 bp) was cloned using TOPO-XL cloning kit (Invitrogen) into the pCR-XL-TOPO vector. The SphI and SalI gana-1 restriction fragment was recloned into the GFP reporter vector pPD95.67. The in-frame nature of the insert was confirmed by sequencing. --precise ends. | ||
| Clone | pCR-XL-TOPO | ||
| Used_for | Transgene_construct | WBTransgene00028408 | |
| Reference | WBPaper00024995 |
