WormBase Tree Display for Construct: WBCnstr00009460
expand all nodes | collapse all nodes | view schema
WBCnstr00009460 | Summary | [PQN-47::GFP; pttx-3::dsRed] | |
---|---|---|---|
Driven_by_gene | WBGene00004134 | ||
Gene | WBGene00004134 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Translational_fusion | ||
Construction_summary | This construct contains all endogenous genomic features; the full promoter to upstream gene F59B10.2, introns, and full endogenous 3'UTR. The 5' fragment contains the promoter and first two and half exons from PCR of genomic DNA using oligos 1stpartexon3pqn-47low agcagttcccggttggctc and promoterpqn-47-7124low attgctaaagccatcagaggg. The 3' fragment is the C terminal part of pqn-47 (2nd half of exon 3 thru the 3'UTR) amplified from genomic DNA using oligos: 2ndpartexon3pqn-47up gcagtcaatcaacctacaaaca and after3utrpqn 47low aaacatcacaggtacaatcgg. GFP was amplified from pD95_79 with oligos: gfptopqnlow tgtttgtaggttgattgactgctttgtatagttcatccatgcc and gfptopqnup gagccaaccgggaactgctatgagtaaaggagaagaacttttc. | ||
Used_for | Transgene_construct | WBTransgene00009798 | |
Interactor | WBInteraction000505088 | ||
WBInteraction000505089 | |||
WBInteraction000505090 | |||
WBInteraction000505091 | |||
WBInteraction000505146 | |||
WBInteraction000505147 | |||
WBInteraction000505148 | |||
WBInteraction000505149 | |||
Reference | WBPaper00040293 |