WormBase Tree Display for Construct: WBCnstr00006816
expand all nodes | collapse all nodes | view schema
| WBCnstr00006816 | Summary | [Psur-2::CAM-1::GFP, unc-119(+)] | |
|---|---|---|---|
| Driven_by_gene | WBGene00006349 | ||
| Gene | WBGene00000289 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | 5.5 kb of Psur-2 was amplified from cosmid F39B2 using forward primer CGCGGATCCCGAAATTCGGTAGATTTGGGC and reverse primer ATAGTTTAGCGGCCGCTTGTTGCCTGAAAATGTAATAATTTTC.This promoter was placed upstream of a CAM-1b::GFP backbone using 5' BamHI and 3' NotI sites. (Green et al., 2007). | ||
| Used_for | Transgene_construct | WBTransgene00006988 | |
| Reference | WBPaper00031110 | ||
| WBPaper00032129 |
