Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00005429

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00005429Summary[aex-2::aex-2-mCherry]
Driven_by_geneWBGene00000085
GeneWBGene00000085
Fusion_reportermCherry
Type_of_constructTranslational_fusion
Construction_summaryFosmid T14B1.2 containing aex-2 sequence was transformed into recombineering strain SW102. A galK gene was inserted into the C -terminus of the aex-2 coding region with following oligonucleotides: forward GACGAGCATCTGAAAGGCCGCCGGAGCACACCCCCTTACGGTGTGATATGCCTGTTGACAATTAATCATCGGCA, reverse CATTTTTTCCACAAGTTTTACTTACATACATTGCGAATTACTACGATCTATCAGCACTGTCCTGCTCCTT. The galK gene was subsequently replaced by the mCherry gene by homologous recombination with the following oligonucleotides: forward GACGAGCATCTGAAAGGCCGCCGGAGCACACCCCCTTACGGTGTGATATGATGGTGAGCAAGGGCGAGGAG, reverse CATTTTTTCCACAAGTTTTACTTACATACATTGCGAATTACTACGATCTACTTGTACAGCTCGTCCATGCC. In the final step, the whole fragment, which contains aex-2 promoter, aex-2 coding sequence, mCherry coding sequence, and 3'-UTR, was gap repaired into an Amp containing vector backbone using oligonucleotides for ward CATTGATCTGCCGCATGATGAAGTACCAAGTCTGAATGATGAAGAATTTCATTCGTTATGCATTATGGGTAC and reverse AATCAAACGACATTAACGATTTCTCAAAAAAAAAAAACTTTAGGAAAACATACCAATCTAAGTCTGTGCTCC and was used to make transgenes jsEx937 and jsEx938. --precise ends.
Used_forTransgene_constructWBTransgene00005508
ReferenceWBPaper00032261