WormBase Tree Display for Antibody: WBAntibody00000754
expand all nodes | collapse all nodes | view schema
WBAntibody00000754 | Summary | Polyclonal rabbit antibody against WSP-1 recombinant protein. | ||
---|---|---|---|---|
Public_name | [cgc6663:wsp-1_b | |||
Gene | WBGene00006957 | |||
Isolation | Original_publication | WBPaper00024256 | ||
Location | NG | |||
Clonality | Polyclonal | |||
Antigen | Protein | A 354-bp fragment from the VCA domain of wsp-1 was amplified to introduce BglII/EcoRI sites using the primer pair (AGATCTTCGGTGCTCGCAAAACTAC) and (GAATTCCTAATCTGACCATTCATTTTTGTCATC). The PCR product was digested with BglI/EcoRI and cloned into pGEX4T.2 (Amersham, Buckinghamshire, UK) to create a glutathione S-transferase fusion that was purified from bacteria using standard techniques and injected into rabbits. A maltose binding protein-VCA fusion was created using the vector pMAL-c2 (New England Biolabs, Beverly, MA) from the same BglII/EcoRI fragment above and used for affinity purification of antisera. | ||
Animal | Rabbit | |||
Reference | WBPaper00024256 |