WormBase Tree Display for Antibody: WBAntibody00000686
expand all nodes | collapse all nodes | view schema
| WBAntibody00000686 | Summary | Rat polyclonal antibodies against recombinant protein. | ||
|---|---|---|---|---|
| Public_name | [cgc6149]:nmy-1_a | |||
| Gene | WBGene00003776 | |||
| Isolation | Original_publication | WBPaper00006149 | ||
| Location | HR | |||
| Clonality | Polyclonal | |||
| Antigen | Protein | GST-NMY-1 fusion protein encoding C-terminal region amino acids 941-1133, which was amplified using the following primers: forward (containing the BamHI restriction site) 5TACAGGATCCGAGAAACCGTCCGTGATCTC3 and reverse (containing the EcoRI restriction site) 5CGAGGAATTCCCTTGTCATTTCTGCCTTAT3 and cloned directionally into the pGEX-3X vector (Pharmacia). | ||
| Animal | Rat | |||
| Expr_pattern | Expr2738 | |||
| Interactor | WBInteraction000501467 | |||
| Reference | WBPaper00006149 | |||
| WBPaper00050431 | ||||
| WBPaper00041027 |
