WormBase Tree Display for Antibody: WBAntibody00000606
expand all nodes | collapse all nodes | view schema
| WBAntibody00000606 | Summary | Affinity-purified polyclonal rabbit antibody against SAS-4 recombinant protein. Antibodies to the fusion protein were generated in rabbits and affinity purified. | ||
|---|---|---|---|---|
| Public_name | [cgc5739]::anti-SAS-4 | |||
| Gene | WBGene00004726 | |||
| Isolation | Original_publication | WBPaper00005739 | ||
| Location | TH | |||
| UV | ||||
| Clonality | Polyclonal | |||
| Antigen | Protein | 6xHis tagged full-length SAS-4 was prepared by amplifying the cDNA, yk425b11, using the following primers: CGCGCGGGATCCGCTTCCGATGAAAATATCGGTG and CGCGCGCTCGAGTCATTTTTTCCACTGGAACAAAGTT, digesting the product with BamHI/XhoI and cloning into pRSET-A (Invitrogen). | ||
| Animal | Rabbit | |||
| Expr_pattern | Expr2460 | |||
| Expr2459 | ||||
| Reference | WBPaper00030742 | |||
| WBPaper00005739 | ||||
| WBPaper00028853 | ||||
| WBPaper00049397 |
