WormBase Tree Display for Sequence: F02H6

F02H6 DNA: F02H6 34107
  SMap: S_child (11)
  Structure: From: Source: CHROMOSOME_IV
    Overlap_right: Y64G10A 34007
    Overlap_left: K01G12
    Clone_left_end: F02H6 1
    Clone_right_end: F02H6 34107
  DB_info: Database: EMBL NDB_AC Z82265
        NDB_SV Z82265.1
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: McMurray AA
    From_laboratory: HX
    Date_directory: 980224
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: F02H6
  Properties: Genomic_canonical
    Checksum: MD5: 11a746f9a3e23d68b98eae783ee9b2ca
    Status: Finished: 24 Feb 1998 00:00:00
      Submitted: 11 Nov 1996 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-IV Ends: Left: 7303
        Right: 7321
  Interpolated_map_position: IV 11.5298
  Assembly_tags: Finished Left 1 4 F02H6
    Clone left end 1 4 F02H6
    Finished Right 34104 34107 F02H6
    Clone right end 34104 34107 F02H6
    annotation 13851 18379 Tandem repeat typical repeat element TTCCTTTCGTGCAAAGGAATGTCCTCTAGCATTCGAGCATGCACAAAGACACCGACAACTCCACAGTCTCTCCCAC (a 66-mer). Estimated size 4.5kb, from restriction digest data.
      20941 21170 [y ] Tandem repeat Comment: Restriction digest confirms size of this repeat to be 2.4kb.
      21441 21619 [ ] Tandem repeat Comment: size confirmed by restriction digest.
  Method: Genomic_canonical