WormBase Tree Display for Sequence: F02H6
expand all nodes | collapse all nodes | view schema
| F02H6 | DNA | F02H6 | 34107 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child (72) | ||||
| CDS_child (168) | ||||||
| Transcript (77) | ||||||
| Pseudogene | F02H6.1 | 2255 | 4772 | |||
| F02H6.4a | 19105 | 22151 | ||||
| F02H6.4b | 21884 | 22151 | ||||
| F02H6.4c | 10556 | 22151 | ||||
| Nongenomic | yk258a8 | 6492 | 8281 | |||
| PCR_product (24) | ||||||
| Allele (526) | ||||||
| Oligo_set | Aff_F02H6.1 | 4123 | 4772 | |||
| Aff_F02H6.2 | 883 | 1482 | ||||
| Aff_F02H6.3 | 6478 | 7260 | ||||
| Aff_F02H6.4 | 19901 | 20550 | ||||
| Aff_F02H6.5 | 25846 | 27349 | ||||
| Aff_F02H6.6 | 33257 | 32328 | ||||
| Aff_F02H6.7 | 30226 | 28910 | ||||
| Feature_object (177) | ||||||
| Feature_data | F02H6:Polysome | 1 | 34107 | |||
| F02H6:TranscriptionallyActiveRegion | 1 | 34107 | ||||
| F02H6:ChIPSeqTF | 1 | 34107 | ||||
| F02H6:TRF | 1 | 34107 | ||||
| F02H6:Dust | 1 | 34107 | ||||
| F02H6:inverted | 1 | 34107 | ||||
| Homol_data (20) | ||||||
| Structure | From | Source | CHROMOSOME_IV | |||
| Overlap_right | Y64G10A | 34007 | ||||
| Overlap_left | K01G12 | |||||
| Clone_left_end | F02H6 | 1 | ||||
| Clone_right_end | F02H6 | 34107 | ||||
| DB_info | Database | EMBL | NDB_AC | Z82265 | ||
| NDB_SV | Z82265.1 | |||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | McMurray AA | ||||
| From_laboratory | HX | |||||
| Date_directory | 980224 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | F02H6 | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | 11a746f9a3e23d68b98eae783ee9b2ca | ||||
| Status | Finished | 24 Feb 1998 00:00:00 | ||||
| Submitted | 11 Nov 1996 00:00:00 | |||||
| Annotated | 01 Jan 1980 00:00:00 | |||||
| Map | Sequence-IV | Ends | Left | 7303 | ||
| Right | 7321 | |||||
| Interpolated_map_position | IV | 11.5298 | ||||
| Assembly_tags | Finished Left | 1 | 4 | F02H6 | ||
| Clone left end | 1 | 4 | F02H6 | |||
| Finished Right | 34104 | 34107 | F02H6 | |||
| Clone right end | 34104 | 34107 | F02H6 | |||
| annotation | 13851 | 18379 | Tandem repeat typical repeat element TTCCTTTCGTGCAAAGGAATGTCCTCTAGCATTCGAGCATGCACAAAGACACCGACAACTCCACAGTCTCTCCCAC (a 66-mer). Estimated size 4.5kb, from restriction digest data. | |||
| 20941 | 21170 | [y ] Tandem repeat Comment: Restriction digest confirms size of this repeat to be 2.4kb. | ||||
| 21441 | 21619 | [ ] Tandem repeat Comment: size confirmed by restriction digest. | ||||
| Method | Genomic_canonical |
