Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7264

expand all nodes | collapse all nodes | view schema

Name Class

Expr7264Expression_of (2)
HomolHomol_homolCHROMOSOME_V:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[cul-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAACTTCATGAAAAATGTGCGT] 3' and primer B 5' [TCTGATGGTCTCTCTCTCCGA] 3'.
PatternAdult Expression: intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; hypodermis; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC11694
ReferenceWBPaper00006525
TransgeneWBTransgene00002661