Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7257

expand all nodes | collapse all nodes | view schema

Name Class

Expr7257Expression_ofGeneWBGene00014092
Reflects_endogenous_expression_ofWBGene00014092
HomolHomol_homolZK822:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[ZK822.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAACACGAAGAGCTGATTTC] 3' and primer B 5' [TGAAACGGTTGAAGACGTGA] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; Nervous System; head neurons; amphids; unidentified cells in head;
Larval Expression: pharynx; intestine - posterior cells; rectal gland cells; anal depressor muscle; body wall muscle; Nervous System; head neurons; amphids; unidentified cells in head;
RemarkStrain: BC10713
ReferenceWBPaper00006525
TransgeneWBTransgene00004241