Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7235

expand all nodes | collapse all nodes | view schema

Name Class

Expr7235Expression_ofGeneWBGene00014023
Reflects_endogenous_expression_ofWBGene00014023
HomolHomol_homolZK637:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[ZK637.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCTCGCACTCTCCATTCTT] 3' and primer B 5' [CCTGAACGTTGTTTTGTTTGAA] 3'.
PatternAdult Expression: Reproductive System; vulva other; excretory cell; Nervous System; nerve ring; head neurons; tail neurons;
Larval Expression: rectal epithelium; Reproductive System; distal tip cell; developing vulva; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC13661
ReferenceWBPaper00006525
TransgeneWBTransgene00003243