WormBase Tree Display for Expr_pattern: Expr7223
expand all nodes | collapse all nodes | view schema
Expr7223 | Expression_of | Gene | WBGene00001118 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001118 | ||
Homol | Homol_homol | ZK520:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005394 | ||
WBbt:0005735 | |||
WBbt:0006751 | |||
WBbt:0006753 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [ZK520.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTAGGATTTTATTTCCACCCAC] 3' and primer B 5' [TGAATGAAGATCTCCGTTGTTTT] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : subset of amphids | ||
Strain: BC13200 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003103 |