Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7209

expand all nodes | collapse all nodes | view schema

Name Class

Expr7209Expression_of (2)
HomolHomol_homolZK370:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[ZK370.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTCTGACACTCGGACATGC] 3' and primer B 5' [AACTGATCGAGATAACCGCATT] 3'.
PatternAdult Expression: pharynx; Reproductive System; spermatheca; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; pharyngeal neurons; tail neurons;
Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; pharyngeal neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC14196
ReferenceWBPaper00006525
TransgeneWBTransgene00003439