WormBase Tree Display for Expr_pattern: Expr7201

Expr7201 Expression_of: Gene: WBGene00013957
    Reflects_endogenous_expression_of: WBGene00013957
  Homol: Homol_homol: ZK265:Expr
  Expression_data: Life_stage: WBls:0000041
    Anatomy_term: WBbt:0003679
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0006751
      WBbt:0006759
  Type: Reporter_gene: [ZK265.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAAGGAGACAAACGGAACAC] 3' and primer B 5' [CGGTAGCATTGATCATAGTTGATT] 3'.
  Pattern: Adult Expression: Nervous System; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : incomplete. Will be updated.
    Strain: BC12009
  Reference: WBPaper00006525
  Transgene: WBTransgene00002788