Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7191

expand all nodes | collapse all nodes | view schema

Name Class

Expr7191Expression_ofGeneWBGene00044072
Reflects_endogenous_expression_ofWBGene00044072
HomolHomol_homolZK1128:Expr
Expression_data (2)
TypeReporter_gene[ZK1128.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAAAGCTTCTAGTTTTCGACG] 3' and primer B 5' [CGCGCTTGAGTTTGGATT] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population and mosaic tissues.
Strain: BC14556
ReferenceWBPaper00006525
TransgeneWBTransgene00003603