Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7108

expand all nodes | collapse all nodes | view schema

Name Class

Expr7108Expression_ofGeneWBGene00022127
Reflects_endogenous_expression_ofWBGene00022127
HomolHomol_homolY71F9B:Expr
Expression_dataLife_stage (2)
Anatomy_term (17)
TypeReporter_gene[Y71F9B.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGGTCAAAACCCACTTCTCA] 3' and primer B 5' [GCGCTGGAAAATTGGATG] 3'.
PatternAdult Expression: pharynx; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; rectal gland cells; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC13624
ReferenceWBPaper00006525
TransgeneWBTransgene00003229