WormBase Tree Display for Expr_pattern: Expr7103
expand all nodes | collapse all nodes | view schema
Expr7103 | Expression_of | Gene | WBGene00012403 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012403 | ||
Expression_data (2) | |||
Type | Reporter_gene | [srz-45::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCACACCTTGAAGAGCG] 3' and primer B 5' [GGTGGTGTTGATCTGGAAGTC] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; | ||
Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; | |||
Picture | WBPicture0000006736 | ||
WBPicture0000006737 | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. | ||
Strain: BC14765 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003702 |