WormBase Tree Display for Expr_pattern: Expr7084
expand all nodes | collapse all nodes | view schema
Expr7084 | Expression_of | Gene | WBGene00013360 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013360 | ||
Homol | Homol_homol | Y60A3A:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (7) | |||
Type | Reporter_gene | [Y60A3A.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCACAGAACGAATGTTGATT] 3' and primer B 5' [GGGGATTTTGAGGGAAAAAGT] 3'. | |
Pattern | Adult Expression: gonad sheath cells; Nervous System; head neurons; amphids; neurons along body; PVT interneuron; tail neurons; | ||
Larval Expression: gonad sheath cells; Nervous System; head neurons; amphids; neurons along body; PVT interneuron; | |||
Remark | Also expressed in (comments from author) : Low intensity GFP in head . Expression in gonad sheath cells is exclusively in pair 5, next to the spermatheca. | ||
Strain: BC14376 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003523 |