WormBase Tree Display for Expr_pattern: Expr7061
expand all nodes | collapse all nodes | view schema
| Expr7061 | Expression_of | Gene | WBGene00004047 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004047 | ||||
| Homol | Homol_homol | Y55F3AL:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0003681 | ||||
| WBbt:0005735 | |||||
| WBbt:0005741 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005747 | |||||
| WBbt:0005753 | |||||
| WBbt:0005772 | |||||
| WBbt:0005813 | |||||
| WBbt:0005821 | |||||
| WBbt:0006751 | |||||
| Type | Reporter_gene | [plx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATCGCAATTTTTGCTGGT] 3' and primer B 5' [GGAGAAATGTGGGGATTTCAT] 3'. | |||
| Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; | ||||
| Larval Expression: pharynx; body wall muscle; seam cells; unidentified cells in tail ; | |||||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
| Strain: BC10792 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00002390 |
