WormBase Tree Display for Expr_pattern: Expr7053
expand all nodes | collapse all nodes | view schema
Expr7053 | Expression_of | Gene | WBGene00003008 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003008 | ||||
Homol | Homol_homol | Y54G2A:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0006751 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [Y54G2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGATGGTTTTGGAAAGAGTT] 3' and primer B 5' [ATCGATCAGTTGGGATTTATGG] 3'. | |||
Pattern (2) | |||||
Picture | WBPicture0000006914 | ||||
WBPicture0000006915 | |||||
Remark | Also expressed in (comments from author) : Observation in Apr vs Oct 2005: Apr is posted and was low intensity GFP. In Oct, nothing but the proximal tip of the gonad expressed GFP. | ||||
Strain: BC14240 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004236 |