Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7034

expand all nodes | collapse all nodes | view schema

Name Class

Expr7034Expression_ofGeneWBGene00013143
Reflects_endogenous_expression_ofWBGene00013143
HomolHomol_homolY53C12B:Expr
Expression_data (2)
TypeReporter_gene[Y53C12B.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACTTGTTGACTGTCGGATT] 3' and primer B 5' [TGATAGGTTCAGTGATTTCACCTT] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; unidentified cells in body ;
Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC13375
ReferenceWBPaper00006525
TransgeneWBTransgene00003150