Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6993

expand all nodes | collapse all nodes | view schema

Name Class

Expr6993Expression_of (2)
HomolHomol_homolY47G6A:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[Y47G6A.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCAGGGTGTCCCTTTCT] 3' and primer B 5' [GATTAAATGGACAAGTTGCTGTG] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; hypodermis; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;
Larval Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;
RemarkStrain: BC10588
ReferenceWBPaper00006525
TransgeneWBTransgene00004230