WormBase Tree Display for Expr_pattern: Expr6973
expand all nodes | collapse all nodes | view schema
Expr6973 | Expression_of | Gene | WBGene00003413 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003413 | ||
Homol | Homol_homol | Y43F8C:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [mrp-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCACTGTTGAGCCGTTTTC] 3' and primer B 5' [tgacgacaattttaccgaaag] 3'. | |
Pattern | Adult Expression: intestine; body wall muscle; Nervous System; head neurons; | ||
Larval Expression: intestine; body wall muscle; Nervous System; head neurons; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10031 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002031 |