WormBase Tree Display for Expr_pattern: Expr6914
expand all nodes | collapse all nodes | view schema
Expr6914 | Expression_of | Gene | WBGene00021292 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00021292 | ||||
Homol | Homol_homol | Y25C1A:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0003822 | |||||
WBbt:0003833 | |||||
WBbt:0004292 | |||||
WBbt:0005747 | |||||
WBbt:0005772 | Partial | ||||
Remark | anterior cells | ||||
WBbt:0005788 | |||||
WBbt:0005812 | |||||
WBbt:0005813 | |||||
WBbt:0005821 | |||||
Type | Reporter_gene | [Y25C1A.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGGTTTTTATTGCGTTTTT] 3' and primer B 5' [AGCTGATTGTGGAGGAGCTG] 3'. | |||
Pattern | Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; excretory cell; | ||||
Larval Expression: pharynx; pharyngeal gland cells; intestine - anterior cells; body wall muscle; excretory cell; unidentified cells; | |||||
Picture | WBPicture0000006766 | ||||
Remark | Also expressed in (comments from author) : Adult GFP is lower intensity than larval and embryo. | ||||
Strain: BC10453 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004221 |