WormBase Tree Display for Expr_pattern: Expr6906
expand all nodes | collapse all nodes | view schema
Expr6906 | Expression_of | Gene | WBGene00021225 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00021225 | ||
Homol | Homol_homol | Y19D10A:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [Y19D10A.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCCGATTCACTGAAAAGC] 3' and primer B 5' [TTTAATATTTTGGCGGAAGTTAGA] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells; | ||
Larval Expression: intestine; Nervous System; head neurons; tail neurons; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC11566 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002622 |