WormBase Tree Display for Expr_pattern: Expr6887
expand all nodes | collapse all nodes | view schema
| Expr6887 | Expression_of | Gene | WBGene00013732 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00013732 | ||
| Homol | Homol_homol | Y111B2A:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005107 | ||
| WBbt:0005735 | |||
| WBbt:0006751 | |||
| Type | Reporter_gene | [Y111B2A.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACATCGAAATTTTTGGTTTGG] 3' and primer B 5' [TTGTGAGCCTTGATGAATAAAGAA] 3'. | |
| Pattern | Adult Expression: Nervous System; head neurons; labial sensilla; | ||
| Larval Expression: Nervous System; head neurons; labial sensilla; | |||
| Remark | Also expressed in (comments from author) : Neural expression looks like the inner or outer labial sensilla. Larvae have more GFP than adults.Embryo incomplete. To be updated. | ||
| Strain: BC15005 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003828 |
