WormBase Tree Display for Expr_pattern: Expr6858
expand all nodes | collapse all nodes | view schema
Expr6858 | Expression_of | Gene | WBGene00012348 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012348 | ||||
Homol | Homol_homol | W08G11:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0003681 | |||||
WBbt:0004506 | |||||
WBbt:0004520 | |||||
WBbt:0005300 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0005812 | |||||
WBbt:0005813 | |||||
WBbt:0006749 | |||||
WBbt:0006751 | |||||
WBbt:0006753 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [W08G11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGTCTCGTCTTGTTTCTACAGT] 3' and primer B 5' [CCGCTTCCGTGGATTTTT] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||||
Strain: BC14613 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003625 |