Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6857

expand all nodes | collapse all nodes | view schema

Name Class

Expr6857Expression_ofGeneWBGene00021093
Reflects_endogenous_expression_ofWBGene00021093
HomolHomol_homolW08F4:Expr
Expression_dataLife_stage (2)
Anatomy_term (18)
TypeReporter_gene[W08F4.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCAGGCGGAGACTAACG] 3' and primer B 5' [AAGAGCGATTTTCACGTGTTG] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; neurons along body; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; neurons along body; tail neurons; unidentified cells in tail ;
RemarkStrain: BC14396
ReferenceWBPaper00006525
TransgeneWBTransgene00003534