Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6826

expand all nodes | collapse all nodes | view schema

Name Class

Expr6826Expression_ofGeneWBGene00006773
Reflects_endogenous_expression_ofWBGene00006773
HomolHomol_homolW02D3:Expr
Expression_data (2)
TypeReporter_gene[unc-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCTTCATTCATGTTTTGGTTTTT] 3' and primer B 5' [ACGATGCCTTGATTTTTACTGAA] 3'.
PatternAdult Expression: pharynx; body wall muscle; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : No comment.
Strain: BC11588
ReferenceWBPaper00006525
TransgeneWBTransgene00002564