Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6800

expand all nodes | collapse all nodes | view schema

Name Class

Expr6800Expression_of (2)
HomolHomol_homolT28C6:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[T28C6.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGCAAGAATAACGATTCCA] 3' and primer B 5' [GAGGTTTTGTCCTCGATTTCTG] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; neurons along body; tail neurons;
RemarkStrain: BC15894
ReferenceWBPaper00006525
TransgeneWBTransgene00004123