WormBase Tree Display for Expr_pattern: Expr6776
expand all nodes | collapse all nodes | view schema
Expr6776 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | T26A5:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005300 | |||||
WBbt:0005735 | |||||
WBbt:0005772 | Partial | ||||
Remark | posterior cells | ||||
WBbt:0005813 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [dlc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTTTGTGATCGTCGGATTTA] 3' and primer B 5' [ATTTTGAACGGATTTGGCTG] 3'. | |||
Pattern | Adult Expression: pharynx; intestine - posterior cells; Nervous System; ventral nerve cord; head neurons; tail neurons; | ||||
Larval Expression: pharynx; intestine - posterior cells; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC10571 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002318 |