Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6774

expand all nodes | collapse all nodes | view schema

Name Class

Expr6774Expression_of (2)
HomolHomol_homolT26A5:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[set-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTACGCTCATCAGGCAGTAGTTT] 3' and primer B 5' [CCTTCGAGTGACACCGCT] 3'.
PatternAdult Expression: pharynx; arcade cells; intestine; Reproductive System; vulval muscle; vulva other; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head;
Larval Expression: arcade cells; intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head;
RemarkAlso expressed in (comments from author) : unidentified cells in head, possibly labial sensilla.
Strain: DM12747
ReferenceWBPaper00006525
TransgeneWBTransgene00001944