Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6758

expand all nodes | collapse all nodes | view schema

Name Class

Expr6758Expression_ofGeneWBGene00020770
Reflects_endogenous_expression_ofWBGene00020770
HomolHomol_homolT24D11:Expr
Expression_data (2)
TypeReporter_gene[T24D11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAGTTCTACTTTTTGGCGA] 3' and primer B 5' [AATGACAAAGAACAACAATCGGT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC14012
ReferenceWBPaper00006525
TransgeneWBTransgene00003367