Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6752

expand all nodes | collapse all nodes | view schema

Name Class

Expr6752Expression_of (2)
HomolHomol_homolT23G5:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[rnr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAAATTCGCAATCACAG] 3' and primer B 5' [TTGTAACGTTGGATAACTGGAAAA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; head neurons; unidentified cells in body ;unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC11321
ReferenceWBPaper00006525
TransgeneWBTransgene00002558