WormBase Tree Display for Expr_pattern: Expr6730
expand all nodes | collapse all nodes | view schema
| Expr6730 | Expression_of | Gene | WBGene00020647 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00020647 | ||
| Homol | Homol_homol | T21D12:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (25) | |||
| Type | Reporter_gene | [T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'. | |
| Pattern (2) | |||
| Remark | Also expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis | ||
| Strain: BC11319 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002557 |
